Ethical approval for this study was obtained from the Animal Ethics Committee, Faculty of Veterinary Medicine, Universitas Wijaya Kusuma Surabaya, Indonesia (Ethical Approval No.: 170-KKE-2025). Permission and informed consent were obtained from quail owners or vendors before cloacal swab collection. To minimize animal stress and discomfort, all sampling procedures were performed by trained personnel using gentle manual restraint, and no invasive procedures or sedation were applied during sample collection.

This cross-sectional, laboratory-based observational study was conducted from November to December 2024 to assess MDR E. coli and iron-related virulence genes in quails at the market level.

A total of 150 cloacal swab samples were collected, with the sample size determined based on feasibility considerations and previous poultry AMR surveillance studies, which typically use 100–200 samples to estimate prevalence at the market level. This sample size was deemed sufficient to provide an initial estimation of the occurrence of MDR E. coli in quails sold in traditional markets in Surabaya.

Samples were obtained from quails sold in five traditional markets (Turi, Bratang, Cemara Pabean, Kupang, and Benowo) in Surabaya, Indonesia. These markets were purposively selected as major traditional poultry trading centers, geographically distributed across Surabaya, and serving as primary supply points for live quails to the local population, making them representative of market level quail distribution within the city.

A random sampling procedure was applied at the vendor level within each market. On the sampling day, vendors selling live quails were enumerated, and to minimize selection bias, individual quails were selected using a simple random technique (every nth bird). Only apparently healthy quails intended for sale, regardless of sex, were included, while visibly sick, injured, or dead birds were excluded to ensure sample quality. Information on age and farm-origin was not available at the market level and thus could not be used as an inclusion criterion.

The swabs were placed in sterile transport media and transported in a cooled container to the Veterinary Public Health Laboratory, Faculty of Veterinary Medicine, Universitas Wijaya Kusuma Surabaya, for further analysis.

Cloacal swab samples were first enriched in buffered peptone water and incubated aerobically at 37°C for 18–24 h. The enriched samples were then streaked onto eosin methylene blue agar (EMBA) and MacConkey agar plates and incubated aerobically at 37°C for 24 h. Colonies exhibiting a characteristic green metallic sheen on EMBA or lactose-fermenting pink colonies on MacConkey agar were presumptively identified as E. coli.

Presumptive colonies were further examined by Gram staining and confirmed using a series of biochemical tests, including Triple Sugar Iron Agar (TSIA), Simmons Citrate Agar (SCA), Sulfide Indole Motility (SIM), and Methyl Red–Voges Proskauer (MR–VP), following standard protocols [19, 20]. Reference quality control strains, including E. coli ATCC 25922, were used in parallel to ensure the accuracy of culture and biochemical tests. All ambiguous or atypical colonies were retested in duplicate to confirm their identity and ensure repeatability.

Antibiotic susceptibility testing was performed using the Kirby–Bauer disk diffusion method, in which bacterial suspensions were adjusted to a 0.5 McFarland turbidity standard and uniformly spread onto Mueller–Hinton agar plates. Antibiotic-impregnated disks were aseptically placed on the agar surface, followed by aerobic incubation at 37°C for 18–24 h. The tested antibiotics were selected based on their clinical relevance in poultry and human medicine and their common usage in the local poultry sector.

The following antibiotics and their disk concentrations were used: aztreonam (ATM, 30 µg), ciprofloxacin (CIP, 5 µg), tetracycline (TE, 30 µg), kanamycin (K, 30 µg), and chloramphenicol (C, 30 µg). Inhibition zone diameters were measured in millimeters and interpreted according to the specific breakpoints provided in the Clinical and Laboratory Standards Institute (CLSI) document M100, 2023 edition [21], for Enterobacteriaceae. Quality control was performed using E. coli ATCC 25922 in parallel with the test isolates.

Bacterial isolates were classified as resistant, intermediate, or susceptible based on CLSI standards. MDR was defined as resistance to three or more antibiotic classes, grouped as follows: β-lactams (ATM), fluoroquinolones (CIP), tetracyclines (TE), aminoglycosides (K), and phenicols (C). This definition reflects phenotypic MDR, indicating the isolate’s resistance profile, and does not necessarily correspond to clinical treatment failure but provides a standardized measure to identify high-risk isolates for surveillance purposes [22, 23].

PCR was used to detect the iron acquisition gene iroN in E. coli isolates. Genomic DNA was extracted from overnight pure bacterial colonies grown on nutrient agar using a commercial bacterial DNA extraction kit according to the manufacturer’s instructions. DNA concentration and purity were measured using a spectrophotometer prior to PCR amplification. PCR reactions were prepared in a total volume of 25 µL, consisting of 12.5 µL of 2× PCR master mix (including Taq DNA polymerase, 1.5 mM MgCl₂ and 200 µM dNTPs), 0.5 µM of each primer, 2 µL of template DNA (~50 ng), and nuclease-free water to final volume.

The primer set for iroN was as follows: forward: GAGTATTCAACATTTCCGTGTC, reverse: TAATCAGTGAGGCA CCTATCTC, targeting an 861 bp fragment with an annealing temperature of 57°C [24]. The PCR cycling conditions were initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 10 min. Amplicons were visualized by electrophoresis on a 1.5% agarose gel stained with ethidium bromide and viewed under UV light. Positive and negative controls were included in each run to validate the results.

Escherichia coli was isolated from 148 out of 150 cloacal swab samples, yielding an overall prevalence of 98.7%. Isolation rates varied slightly across the sampled traditional markets: 100% (30/30) in Turi, Bratang, and Cemara Pabean; 96.7% (29/30) in Kupang; and 96.7% (29/30) in Benowo (Table 1). Characteristic colonies on EMBA displayed a green metallic sheen, while those on MacConkey agar appeared as pink lactose-fermenting colonies (Figures 1A and 1B). Biochemical confirmation via TSIA, SCA, SIM, and MR–VP tests further validated the isolates as E. coli (Figure 2).

Antibiotic susceptibility testing revealed varying levels of resistance among the 148 E. coli isolates. The highest resistance was observed to CIP at 33.1% (49/148), followed by TE at 22.3% (33/148), ATM at 13.5% (20/148), K at 6.1% (9/148), and C at 4.7% (7/148) (Table 2; Figure 3). Market-specific resistance patterns showed notable differences; for instance, Kupang market exhibited the highest CIP resistance at 55.2% (16/29), while Benowo had the highest TE resistance at 31.0% (9/29).

Four isolates (2.7%; 4/148) were classified as MDR, demonstrating resistance to three or more antibiotic classes. These MDR isolates were distributed as follows: one from Turi (3.3%; 1/30), two from Cemara Pabean (6.7%; 2/30), and one from Kupang (3.4%; 1/29), with none detected in Bratang or Benowo (Table 3). The resistance patterns among these MDR isolates included ATM/CIP/TE (ATM/CIP/TE) in two isolates (PTU29 and PKU21), ATM/CIP/K (ATM/CIP/K) in one isolate (PCP25), and ATM/CIP/TE/K/C (ATM/CIP/TE/K/C) in one isolate (PCP26) (Table 4).

PCR analysis for the iroN gene was performed on the four MDR isolates, resulting in amplicons of the expected 861 bp size for all samples, confirming 100% positivity (Figures 4 and 5). This indicates a complete association between MDR phenotypes and the presence of the iroN virulence gene in the isolated strains.

The results of this study indicate a very high prevalence of E. coli in quail cloacal swab samples sold in five traditional markets in Surabaya. The high isolation rate of E. coli (98.7%) indicates that quail sold in environments with limited sanitation can be important reservoirs for enteric bacteria, including APEC. This finding is consistent with previous studies reporting a high prevalence of Gram-negative bacteria in poultry sold in traditional markets, which is generally caused by cross-contamination, high animal density, and inadequate hygiene facilities [25]. Similar high prevalence rates have also been reported in quail from Spain and Iran, suggesting that quail may serve as consistent reservoirs of E. coli globally [26, 27]. Epidemiologically, these conditions increase the risk of transmission of pathogenic bacteria both between animals and from animals to humans. Although this study did not directly assess human infection, the zoonotic risk remains potential rather than confirmed [28].

Confirmation of E. coli identity through growth characteristics on EMBA, Gram staining, and biochemical tests showed a pattern consistent with the classic description of E. coli. Lactose fermentation, TSIA results with A/A reaction, positive indole, positive MR, and negative VP are highly characteristic combinations of parameters. This confirms that the isolates obtained are truly representative of E. coli, providing a solid basis for further analysis regarding antibiotic resistance and virulent gene detection [29].

The antibiotic resistance profile shows varying levels of resistance between markets, but overall, it shows a concerning pattern, particularly against CIP (33.1%), TE (22.2%), and ATM (13.5%). The high level of CIP resistance is significant, given that fluoroquinolones are key first-line antibiotics for treating Gram-negative bacterial infections in humans and animals [30]. The high level of TE resistance also reflects uncontrolled antibiotic use in the poultry sector, as TE is one of the most commonly used antibiotics as a feed additive and for the treatment of infections [31]. Meanwhile, the relatively low levels of resistance to K and C may reflect their limited use in the field [32].

Differences in resistance levels between markets indicate variations in drug management practices and sanitation in the marketing environment. For example, the high levels of CIP resistance in Kupang (55.1%) and Benowo (41.3%) may reflect the excessive antibiotic exposure of poultry supplied to these markets. Other possible contributing factors include farm-level poultry husbandry practices, differences in suppliers, and the transport conditions of animals before they reach the market [33].

Although only 2.7% of the total isolates were classified as MDR, MDR strains remain a serious health threat. The relatively low MDR prevalence despite high single-drug resistance may reflect the limited accumulation of multiple resistance determinants in quail-derived E. coli compared with broilers or layers, possibly due to shorter-term antibiotic exposure [34]. MDR isolates were found in three markets, indicating a non-localized distribution [35]. The most common MDR pattern was resistance to a combination of ATM, CIP, and TE. Meanwhile, one isolate (PCP26) showed the most broad resistance to all the tested antibiotics. Although this broad resistance pattern is often associated with large plasmids carrying multiple resistance genes, plasmid analysis was not performed in this study, so the plasmid-mediated mechanism remains speculative [36].

The fact that all isolates with MDR patterns showed resistance to ATM aligns with research findings showing that resistance to monobactam antibiotics can be an indicator of strong antibiotic selection pressure and the mobilization of genetic factors in the farming environment [37]. Resistance to CIP and TE along with MDR also reflects common patterns of antibiotic use in the poultry sector [38]. Antibiotic resistance patterns varied between markets, suggesting the presence of localized pressures on antimicrobial selection. These differences may arise from distinct supply chains, varying hygiene standards, and differences in the antimicrobial exposure histories of poultry supplied to each market [39]. Such inter-market variation underscores the existence of micro-ecological AMR niches within urban markets, emphasizing the importance of stratified monitoring to identify points of heightened resistance emergence [40].

The presence of virulence genes associated with the iron acquisition system provides important insights into the potential pathogenicity of MDR E. coli in quail [3]. Four of the 20 ATM-resistant isolates were detected to carry the iroN gene in this study. This gene is a crucial component of the iron transport system that enables bacteria to survive iron-limited conditions in the host [16]. This strengthens the hypothesis that antibiotic selection pressure not only drives the emergence of resistance but may also correlate with the high prevalence of virulence factors [41].

The presence of the iroN gene in some MDR isolates suggests a possible biological link between antibiotic resistance and virulence [42]. However, the mechanistic linkage between iron acquisition and AMR was not directly tested in this study; therefore, it remains hypothetical. Large plasmids found in APEC are often “hybrid,” meaning they carry a combination of resistance and virulence genes, including siderophore systems such as aerobactin and salmochelin [43]. Thus, E. coli isolates carrying the iroN gene may have stronger colonization and invasion capabilities, increasing their potential to cause systemic infections in poultry [44]. The detection of the iroN gene in a subset of MDR E. coli isolates highlight the emerging concept of resistance–virulence convergence. Not all resistant isolates carried iroN, suggesting that rather than indicating a universal linkage, antibiotic selection may selectively enrich isolates with both resistance and survival/virulence traits [45]. This observation emphasizes the potential of certain MDR subpopulations to harbor adaptive traits that enhance fitness in crowded market environments, providing an evolutionary and ecological perspective beyond simple descriptive microbiology [46].

In addition to its role in pathogenicity, the iroN gene functions as a key determinant of bacterial survival under iron-limited and antibiotic-stressed conditions. Its presence may enhance environmental persistence, stress tolerance, and competitive fitness, particularly in the crowded and unsanitary conditions of traditional markets [45]. Therefore, the detection of iroN in MDR E. coli not only reflects virulence potential but may also indicate enhanced survival and dissemination capacity, highlighting the importance of iron acquisition systems in shaping bacterial fitness in market level ecological niches. This study suggests that iron acquisition systems contribute to the environmental fitness of MDR Escherichia coli in traditional market settings [47].

The results confirm that quail in traditional markets in Surabaya, including MDR strains carrying virulence genes related to iron acquisition, are a significant reservoir for APEC. While this suggests potential public health relevance, direct human transmission was not assessed in this study. This has important implications for animal health, public health, and food safety [48]. The One Health approach is essential for monitoring the flow of resistance and virulence genes from the poultry sector to humans [49]. Strengthening antibiotic management, improving market hygiene, and ongoing molecular monitoring are needed to prevent further spread of the disease [50]. From the perspective of One Health, quail sold in traditional markets may serve as a conduit for MDR and virulence gene dissemination [51]. Potential human exposure pathways include direct handling of live birds, slaughtering practices within the markets, and contact with contaminated surfaces or waste, which can facilitate cross-species transmission [52]. This study provides baseline data essential for modeling One Health risks and designing targeted interventions by characterizing MDR and iron acquisition traits at this market interface.